пятница, 28 декабря 2012 г.
вторник, 18 декабря 2012 г.
I1 in Italy
A new article on Italy - Uniparental Markers of Contemporary Italian Population Reveals Details on Its Pre-Roman Heritage (Brisighelli 2012). Unfortunately the authors did not check the M253, which is a bad form. However, the article is on STR haplotypes can predict haplogroup I1.
I got the following data from I1 in Italy:
As we see the greatest frequency of I1 in northern Italy, which is quite expected.
Commercial walk through some results, that in Italy the representation of different subclades I1 (Z139 +, Z140 +, Z382 +, Z63 +, P109 +). Also, many of those who did not check the new SNP. http://www.semargl.me/ru/dna/ydna/country/119/4/
Haplogroup I1 good views to the north and the south of Italy, in the center is almost there.
It is surprising that, according to Article (Brisighelli 2012) are not found in Sicily I1. Although sales data and the article (Di Gaetano 2009) show that in Sicily I1 that stands quite well.
I got the following data from I1 in Italy:
As we see the greatest frequency of I1 in northern Italy, which is quite expected.
Commercial walk through some results, that in Italy the representation of different subclades I1 (Z139 +, Z140 +, Z382 +, Z63 +, P109 +). Also, many of those who did not check the new SNP. http://www.semargl.me/ru/dna/ydna/country/119/4/
Haplogroup I1 good views to the north and the south of Italy, in the center is almost there.
It is surprising that, according to Article (Brisighelli 2012) are not found in Sicily I1. Although sales data and the article (Di Gaetano 2009) show that in Sicily I1 that stands quite well.
понедельник, 17 декабря 2012 г.
воскресенье, 16 декабря 2012 г.
среда, 12 декабря 2012 г.
понедельник, 3 декабря 2012 г.
The genetic atlas
I (M170) The diagnostic marker of Cro-Magnon expansion in Paleolithic Europe
I1 (M253) Represents an early expansion Europids in Paleolithic Northern Europe
I1a (S438) This lineage was able to repopulate Northern Europe in the early Mesolithic
I1a1 (M227) Expanded on the East Bank of the Vistula river and south to the Balkans
I1a1a (M72) Representing a small minority in Eastern Europe
I1a2 (L22) Represents Mesolithic Europid prominence in Scandinavia
I1a2a (P109) Marker of a Europid expansion into Germany
I1a2b (L205) Marker of a Europid expansion into Atlantic Europe
I1a2c (L287) Marker of a prominent Europid population emergence in Finland
I1a2c1 (L258) Accounts for the majority of I (M170) Europid males in Finland
I1a2c1a (L296) A younger lineage that represents a primary portion of I (M170) in Finland
I1a2d (L300) Marker of a less successful Europid expansion into Finland
I1a2e (L813) A southwestern expansion of Nordic Europids
I1a3 (Z58) This population reached Germany +5,000 years ago
I1a3a (Z59) This lineage is the most dominant lineage in I1 (M253) Northern Europids
I1a3a1 (Z60) a lineage that remained predominant in North Germany until the early Bronze age
I1a3a1a (Z140) Marker of Bronze age expansion out of North Germany
I1a3a1a1 (L338) Marker of historic expansion out of North Germany
I1a3a1ab (Z73) This lineage marks a Bronze age back migration into Scandinavia
I1a3a1ac (L573) probably a lineal population in Baltic Germany
I1a3a1ad (L803) Marker of Bronze age Europids in Atlantic Germany
I1a3a2 (Z382) Marker of Neolithic Europids in North Germania
I1a3b (Z138) This population expanded out of Atlantic Germany
I1a4 (Z63) Marker of Mesolithic Europids in Germany & multi episodes of Secondary minor expansions
I1b (Z131) Remnants of a reduced Paleolithic Europid population that emerged in Western Europe
http://thegeneticatlas.com/ I1_Y-DNA.htm
I2 (L68) Represents an early expansion Europids into Paleolithic Southern Europe
I2a (L460) This lineage accounts for the majority of I2 (L68) Southern Europids
I2a1 (P37.2) Marker of Southern Europid expansion out of Alpine Europe
I2a1a (L158) Predominant lineage in Sardinia, the remains of SW European population
I2a1a1 (L160) This population emerged from the L158 population that reached the Bay of Biscay
I2a1a1a (M161) A very small minority in Puerto Rico
I2a1b (L178) This population expanded between the Atlantic & the Vistula River in the Neolithic
I2a1b1 (M359.2) Marks the Bronze age Southwards expansion down the Vistula Valley
I2a1b2 (L161.1) This lineage is the surviving minority of the Western I2a1b (L178) population
I2a1c (L233) Emerged out of I2a1 populations that moved to the North Germany
I2a2 (L35) The Southern Europids of Germany that managed to survive the Eurasid intrusion & expand with it
I2a2a (L34) Expanded out of Germany in Neolithic to the East & West
I2b (L415) The remains of a once important lineage, that was largely reduced by I2a2 (M285) & Eurasid invasions
I2c (L596) Emerged in the Rhineland, was largely reduced by I2a2 (M285) & Eurasid invasions
http://thegeneticatlas.com/I2_Y-DNA.htmвоскресенье, 2 декабря 2012 г.
M507/P259 Gypsy SNP?
Not so long ago M507/P259 fully entered into the category of private SNPs. But new scientific article(Ancestral modal Y-STR haplotype shared among Romani and South Indian populations) has allowed a new look at this SNP.
In our dataset, the I1c-P259 sub-clade was found to comprise all I chromosomes in the Roma from Bogojevo (8%) and about 1/3 of those in Belgrade (4.5%), yet this sub-haplogroup is completely absent from the general population of Serbia (Regueiro et al., 2012).
The predominantly European haplogroup I-M258, on the other hand, which has two foci of frequencies in northern Europe around Scandinavia (I1) and in the Balkan Peninsula (I2) (Rootsi et al., 2004), supports genetic admixture with host populations following their arrival in the Balkans. It is interesting to note that the I1c-P259 sub-clade, which comprises all "I" chromosomes in the Bogojevo population and 4.5% of patrilineages in the Roma from Belgrade, is absent from the general population of Serbia (Regueiro et al., 2012). In addition, the most common I1c-P259 16 loci-haplotype in our Roma collections (DYS19*14, DYS385*14-14, DYS389I*12, DYS389II*28, DYS390*22, DYS391*10, DYS392*11, DYS393*13, DYS437*16, DYS438*10, DYS439*12, DYS448*20, DYS456*14, DYS458*15, DYS635*22, GATA H4*20) is also the most frequently observed Y-STR profile among the Romani from Portugal and Bulgaria (Gusmão et al., 2008). These findings may indicate that the Belgrade and Bogojevo Roma were likely recipients of gene flow from autochthonous European populations prior to their entrance into Serbia.
The database FTDNA as aware of only one case of P259+
In our dataset, the I1c-P259 sub-clade was found to comprise all I chromosomes in the Roma from Bogojevo (8%) and about 1/3 of those in Belgrade (4.5%), yet this sub-haplogroup is completely absent from the general population of Serbia (Regueiro et al., 2012).
The predominantly European haplogroup I-M258, on the other hand, which has two foci of frequencies in northern Europe around Scandinavia (I1) and in the Balkan Peninsula (I2) (Rootsi et al., 2004), supports genetic admixture with host populations following their arrival in the Balkans. It is interesting to note that the I1c-P259 sub-clade, which comprises all "I" chromosomes in the Bogojevo population and 4.5% of patrilineages in the Roma from Belgrade, is absent from the general population of Serbia (Regueiro et al., 2012). In addition, the most common I1c-P259 16 loci-haplotype in our Roma collections (DYS19*14, DYS385*14-14, DYS389I*12, DYS389II*28, DYS390*22, DYS391*10, DYS392*11, DYS393*13, DYS437*16, DYS438*10, DYS439*12, DYS448*20, DYS456*14, DYS458*15, DYS635*22, GATA H4*20) is also the most frequently observed Y-STR profile among the Romani from Portugal and Bulgaria (Gusmão et al., 2008). These findings may indicate that the Belgrade and Bogojevo Roma were likely recipients of gene flow from autochthonous European populations prior to their entrance into Serbia.
The database FTDNA as aware of only one case of P259+
вторник, 25 сентября 2012 г.
New SNP for I1-Z73+
Today came the results of kit 121192 Nissilä/Suomela WTY. Have found two SNPs - L1301, L1302. Let me remind you that the branch Suomela "Z73 +", which departs from the "Z58 +". Its area of distribution is mainly Scandinavia.
Besides Z73 + found in the offspring Varangian Šimon. (Šimon would live in Kievan Rus' for the rest of his life, and he first served Yaroslav I the Wise and later his son.) Quite possibly the new SNPs will help us in the future to understand the migration of the Varangians.
Besides Z73 + found in the offspring Varangian Šimon. (Šimon would live in Kievan Rus' for the rest of his life, and he first served Yaroslav I the Wise and later his son.) Quite possibly the new SNPs will help us in the future to understand the migration of the Varangians.
воскресенье, 23 сентября 2012 г.
German mtDNA in Russia.
In the article "Russian ethnic history inferred from mitochondrial DNA diversity Irina Morozova et al." we find very interesting facts:
Apparently this is another confirmation of the words of the historian Jordanes that the Gothic king took Ermanaric Oka river basin: “thiudos: Inaunxis Vasinabroncas Merens Mordens Imniscaris Rogas Tadzans Athaul Nauego Bubegenas Coldas”.
Being quite distant from the Finno-Ugric group, the Southern Russians consequently differ from the Northern Russians in their closeness to the Germanic group. This difference indicates that the Germanic people played a significant role in the development of the southern, but not the northern segment of the Russian gene pool. In general, the Germanic influence on the formation of the Russians is not as obvious as the impact of the Slavic, Baltic, and Finno-Ugric people. However, strong interactions between the Germanic and Slavic tribes have been found in archeological materials dating from the mid-first millennium B.C. to the early first millennium A.D. These interactions were the strongest on the northern coast of the Black Sea, in the area of the multiethnic Chernyakhov archeological culture (second to fifth centuries A.D.). In the second half of the first millennium A.D., the descendants of this culture colonized the southern regions of the historical Russian area (Sedov, 1994, 1995). However, there is no evidence in the historical literature of the interaction between the Germanic tribes and the Slavs (and later, the Russians) after the Slavic colonization of the East European Plain. Therefore, the Germanic influence could not have occurred after the early part of the first millennium A.D., which was before the eastward Slavic migration (Sedov, 1994, 1995). Apparently, the impact of the Germanic people on the Chernyakhov Slavs affected the gene pool of modern Southern Russians, consequently differentiating them from the Northern Russians (Fig. 6).
It is worth noting that the Ryazan region, though attributed to the central Russian group has a distinct attraction to the southern group, is clearly seen in Fig.5
Apparently this is another confirmation of the words of the historian Jordanes that the Gothic king took Ermanaric Oka river basin: “thiudos: Inaunxis Vasinabroncas Merens Mordens Imniscaris Rogas Tadzans Athaul Nauego Bubegenas Coldas”.
четверг, 13 сентября 2012 г.
New publication. New SNP?
There was a new publication - Contemporary paternal genetic landscape of Polish and German populations: from early medieval Slavic expansion to post-World War II resettlements // European Journal of Human Genetics
Statistics on haplogroup I1.
"A total of 39 different haplogroups have been detected in the studied sample set, including an insertion polymorphism at M91 (M91insT wish a stretch of 10 thymidines) previously observed in two individuals from a large woridwide sample set."
And probably for I1 found new SNP. I speak about SNP M91. Probably in this place there was insertion since M91 marks haplogroup B-T. About it probably also tells "M91insT" inscription.
Geographic locations of studied populations on an ethnolinguistic map of
Central Europe in the early 20th century (Slavic and German-speaking
areas are marked in green and red, respectively). 1 – Kaszuby; 2 –
Kociewie; 3 – Kurpie; 4 – southern Polish pre-war population, studied by
Woźniak et al.; 5 – Lusatia; 6 – western Slovakia (Bratislava region); 7
– Mecklenburg; 8 – western Bavaria (Augsburg region).
Statistics on haplogroup I1.
"A total of 39 different haplogroups have been detected in the studied sample set, including an insertion polymorphism at M91 (M91insT wish a stretch of 10 thymidines) previously observed in two individuals from a large woridwide sample set."
And probably for I1 found new SNP. I speak about SNP M91. Probably in this place there was insertion since M91 marks haplogroup B-T. About it probably also tells "M91insT" inscription.
I think to representatives of all branches of I1 (Z58+, Z63+, L22+, M227+, DF29+, Z131+, M253+) it is necessary to check this SNP. While it is possible to tell that the branch doesn't have this new SNP Z382+.
| Name: | M91 |
|---|---|
| Type: | snp |
| Description: | |
| Source: | M |
| Position: | ChrY:20366926..20366926 (+ strand) |
| Length: | 1 |
| ISOGG_haplogroup: | BT |
| Mutation: | 8T to 9T |
| YCC_haplogroup: | Approx. hg: BT |
| allele_anc: | del |
| allele_der: | ins |
| comments: | Anc/Der reversed since 2011-12-08 |
| count_derived: | 377 |
| count_tested: | 436 |
| primer_f: | GAGCTTGGACTTTAGGACGG |
| primer_r: | AAACTTTAAGGCACTTCTGGC |
| primary_id: | 46372 |
| gbrowse_dbid: | ymap:database |
понедельник, 6 августа 2012 г.
Tatar-I1 in China.
Not long ago an article appeared under the title - Y-chromosome distributions among populations in Northwest China identify significant contribution from Central Asian pastoralists and lesser influence of western Eurasians.
I was attracted by the frequency of haplogroup I among the Tatars.
Localization of the Tatars in China.
I am inclined to think that the Tatars living in China, namely haplogroup I1. At this point I was tempting the information from the laboratory Balanovsky:
Tatars. Sample size-450. (Rootsi 2007, Tambets 2004, Balanovsky in prep., Wells 2001)
N1b- 21,0%
R1a- 19,0%
J2- 8,1%
R1b1b2- 6,0%
E1b1a- 4,0%
O- 3,0%
J1- 1,0%
L- 1,0%
Q- 1,0%
T- 1,0%
At the same thoughts suggests the origin of the Tatars: Tatar migrated to China in the early 19th Century from Europe and Russia. They mixed with Uighur and Kazakh. They maintain their own language, tradition and Islam religion. Their house presents in European style, quite different from Uighur and Kazakh. Their living standard is higher at average since they are good at business and education.
Map of the site laboratory Balanovsky (my mark):
Thus far in the East (in China) from the main area, there may be a local maximum of haplogroup I1 at 30%.
I was attracted by the frequency of haplogroup I among the Tatars.
Localization of the Tatars in China.
I am inclined to think that the Tatars living in China, namely haplogroup I1. At this point I was tempting the information from the laboratory Balanovsky:
Tatars. Sample size-450. (Rootsi 2007, Tambets 2004, Balanovsky in prep., Wells 2001)
N1b- 21,0%
R1a- 19,0%
I1- 13,2%
N1c- 13,0%J2- 8,1%
R1b1b2- 6,0%
E1b1a- 4,0%
O- 3,0%
I2a- 2,8%
C- 2,7%
I2b- 1,8%
G- 1,0%J1- 1,0%
L- 1,0%
Q- 1,0%
T- 1,0%
At the same thoughts suggests the origin of the Tatars: Tatar migrated to China in the early 19th Century from Europe and Russia. They mixed with Uighur and Kazakh. They maintain their own language, tradition and Islam religion. Their house presents in European style, quite different from Uighur and Kazakh. Their living standard is higher at average since they are good at business and education.
Map of the site laboratory Balanovsky (my mark):
Thus far in the East (in China) from the main area, there may be a local maximum of haplogroup I1 at 30%.
воскресенье, 5 августа 2012 г.
The new version of the tree I1-Z58+
This tree is constructed on the basis of Julie Frame Falk - Link.
Geography Z58+ and the downstream subclades.
Tatar clusters haplogroup I1.
We continue to discuss the Tatar clusters I1.
Arsky cluster belongs to the branch Z63+ and currently is the easternmost representative of this branch in Europe.
Arsky cluster belongs to the branch Z63+ and currently is the easternmost representative of this branch in Europe.
Karelian branch L22+ 19=14, 392=13
Finally, Ken said that branch.
http://archiver.rootsweb.ancestry.com/th/read/y-dna-haplogroup-i/2012-07/1341758180
Notice of the Karelian branch in my blog.
http://abbey-roots.blogspot.com/2012/02/karelian-branch-l22-1914-39213.html
http://archiver.rootsweb.ancestry.com/th/read/y-dna-haplogroup-i/2012-07/1341758180
Notice of the Karelian branch in my blog.
http://abbey-roots.blogspot.com/2012/02/karelian-branch-l22-1914-39213.html
Azov Greeks (Urums and Rumei) & Haplogroup I1
We continue the study of the Azov Greeks, descendants of the Crimean Goths.
In the project "I1 Eastern Europe" appeared two sets of Azov Greeks. One set of 67 markers paid for and ordered SNP Z63, a second set of tests paid for the Y-12. We are waiting for the results.
The same information can be obtained on the project page.
In the project "I1 Eastern Europe" appeared two sets of Azov Greeks. One set of 67 markers paid for and ordered SNP Z63, a second set of tests paid for the Y-12. We are waiting for the results.
The same information can be obtained on the project page.
суббота, 31 марта 2012 г.
Gothia prince - Hovra.
Khovrins — the Russian boyar a family occurring from the Crimean princes Gavrasov (Havre).
In «The Russian genealogical book», published the prince P. Dolgoruky, mentions «Gotiya's prince» Stepan (Stephane) Vasilyevich Hovra who with son Grigory left the possession to Moscow at the end of the XIV century. In Moscow it was accepted with honor prince Dmitry Donskim or his son prince Vasily, received a farmstead in the Kremlin, noted on ancient maps of the city. Later Stephane accepted a monkhood under Simone's name, and the son his Grigory Hovra, according to the legend, played important role in the basis in vicinities of Moscow of Simonov of a monastery.
Link
207730 Khovrine Russian Federation I1 13 22 14 10 13-15 11 14 11 12 11 28 15 8-9 8 11 22 16 20 26 12-14-14-15 11 9 19-21 15 16 16 18 35-36 13 11 11 8 15-15 8 11 10 8 9 9 12 22-25 15 10 12 12 16 8 13 25 20 13 13 11 12 11 11 12 11
Link
Coat of arms Golovins.
In «The Russian genealogical book», published the prince P. Dolgoruky, mentions «Gotiya's prince» Stepan (Stephane) Vasilyevich Hovra who with son Grigory left the possession to Moscow at the end of the XIV century. In Moscow it was accepted with honor prince Dmitry Donskim or his son prince Vasily, received a farmstead in the Kremlin, noted on ancient maps of the city. Later Stephane accepted a monkhood under Simone's name, and the son his Grigory Hovra, according to the legend, played important role in the basis in vicinities of Moscow of Simonov of a monastery.
Link
207730 Khovrine Russian Federation I1 13 22 14 10 13-15 11 14 11 12 11 28 15 8-9 8 11 22 16 20 26 12-14-14-15 11 9 19-21 15 16 16 18 35-36 13 11 11 8 15-15 8 11 10 8 9 9 12 22-25 15 10 12 12 16 8 13 25 20 13 13 11 12 11 11 12 11
Link
Coat of arms Golovins.
Look also - Azov Greeks (Urums and Rumei) & Haplogroup I1
четверг, 15 марта 2012 г.
SNP L345
N29579 Jensen Z60+ Z73- L345+
170291 Domke Z60+ Z73? L345+
154151 Luukila Z60+ Z73+ L345+
Interesting SNP think its worth checking out for people from different branches.
170291 Domke Z60+ Z73? L345+
154151 Luukila Z60+ Z73+ L345+
Interesting SNP think its worth checking out for people from different branches.
среда, 14 марта 2012 г.
вторник, 13 марта 2012 г.
Basques & Haplogroup I1
The new publication Martínez-Cruz et al. 2012 is the frequency of haplogroup I1 in various groups of the Basques.
Basque DNA Project - Link
Suevs or Visigoths, that is the question?
Basque DNA Project - Link
Suevs or Visigoths, that is the question?
понедельник, 12 марта 2012 г.
New DNA project - I1>Z58+ and I1>Z63+
All those who have to date received positive results on new SNPs Z58 and Z63 may enter into a new project called - DNA project - I1>Z58+ and I1>Z63+.
Link
The I1>Z58+ and I1>Z63+ project focuses on the investigation of the Z58+ and Z63+ subgroups of the I1 haplogroup. It evolved from the "I1 recLOH - YCAII a,b = 21,21" project, as the discovery of new SNP's made it possible to home in on the specifics of each of the original 21,21 groups in our study. Thus, this project is now SNP-based, and to participate you just need to have tested positive for either Z58 (Z58+) or Z63 (Z63+), or any of their downstream SNP's - terminal SNP's highlighted below:
Project Administrators - Aaron Salles Torres and Julie Frame Falk.
Project participants will be able to find yourself on a kind of tree, which administrators are constantly updating.
Link.
Link
The I1>Z58+ and I1>Z63+ project focuses on the investigation of the Z58+ and Z63+ subgroups of the I1 haplogroup. It evolved from the "I1 recLOH - YCAII a,b = 21,21" project, as the discovery of new SNP's made it possible to home in on the specifics of each of the original 21,21 groups in our study. Thus, this project is now SNP-based, and to participate you just need to have tested positive for either Z58 (Z58+) or Z63 (Z63+), or any of their downstream SNP's - terminal SNP's highlighted below:
*M253 > DF29 > Z63
*M253 > DF29 > Z58
*M253 > DF29 > Z58 > Z138/Z139
*M253 > DF29 > Z58 > Z138/Z139 > L211
*M253 > DF29 > Z58 > Z59
*M253 > DF29 > Z58 > Z59 > Z382
*M253 > DF29 > Z58 > Z59 > Z60/Z61
*M253 > DF29 > Z58 > Z59 > Z60 > L803
*M253 > DF29 > Z58 > Z59 > Z60 > L803 > L802
*M253 > DF29 > Z58 > Z59 > Z60 > L573
*M253 > DF29 > Z58 > Z59 > Z60 > Z73
*M253 > DF29 > Z58 > Z59 > Z60 > Z62
*M253 > DF29 > Z58 > Z59 > Z60 > Z62 > Z140/Z141
*M253 > DF29 > Z58 > Z59 > Z60 > Z62 > Z140/Z141 > L592
*M253 > DF29 > Z58 > Z59 > Z60 > Z62 > Z140/Z141 > L338Project Administrators - Aaron Salles Torres and Julie Frame Falk.
Project participants will be able to find yourself on a kind of tree, which administrators are constantly updating.
Link.
воскресенье, 11 марта 2012 г.
суббота, 3 марта 2012 г.
Native populations of Siberia and haplogroup I1.
A new publication on the populations of Siberia - ХАРЬКОВ В.Н. Структура и филогеография генофонда коренного населения Сибири по маркерам Y-хромосомы (Kharkov V.N. The structure and phylogeography of the gene pool of the indigenous population of Siberia on the Y-chromosome markers.).
I1-M253:
Russian 7.1%
Belarusians 6.0%
Tatars 6.4%
Ukrainians, 4.2%
Evenki 3.1%
Udmurt 2.5%
Maris 1.5%
Tuvans 0.9%
Southern. Altaians 0.7%
Northern Altaians 0%
Buryats 0%
Kazakhs of the Altai 0%
Kety 0%
Yakuts 0%
Eskimo 0%
Kirghiz 0%
Koryak 0%
Nivkh 0%
Teleuts 0%
Udegeytsy 0%
Komi 0%
Khakasses 0%
Khanty 0%
Chukchi 0%
I1-M253:
Russian 7.1%
Belarusians 6.0%
Tatars 6.4%
Ukrainians, 4.2%
Evenki 3.1%
Udmurt 2.5%
Maris 1.5%
Tuvans 0.9%
Southern. Altaians 0.7%
Northern Altaians 0%
Buryats 0%
Kazakhs of the Altai 0%
Kety 0%
Yakuts 0%
Eskimo 0%
Kirghiz 0%
Koryak 0%
Nivkh 0%
Teleuts 0%
Udegeytsy 0%
Komi 0%
Khakasses 0%
Khanty 0%
Chukchi 0%
вторник, 28 февраля 2012 г.
Подписаться на:
Сообщения (Atom)














































