New publication. New SNP?

There was a new publication - Contemporary paternal genetic landscape of Polish and German populations: from early medieval Slavic expansion to post-World War II resettlements // European Journal of Human Genetics

 Geographic locations of studied populations on an ethnolinguistic map of Central Europe in the early 20th century (Slavic and German-speaking areas are marked in green and red, respectively). 1 – Kaszuby; 2 – Kociewie; 3 – Kurpie; 4 – southern Polish pre-war population, studied by Woźniak et al.; 5 – Lusatia; 6 – western Slovakia (Bratislava region); 7 – Mecklenburg; 8 – western Bavaria (Augsburg region).

Statistics on haplogroup I1.

"A total of 39 different haplogroups have been detected in the studied sample set, including an insertion polymorphism at M91 (M91insT wish a stretch of 10 thymidines) previously observed in two individuals from a large woridwide sample set."

And probably for I1 found new SNP. I speak about SNP M91. Probably in this place there was insertion since M91 marks haplogroup B-T. About it probably also tells "M91insT" inscription.

I think to representatives of all branches of I1 (Z58+, Z63+, L22+, M227+, DF29+, Z131+, M253+) it is necessary to check this SNP. While it is possible to tell that the branch doesn't have this new SNP Z382+.

Name:	M91
Type:	snp
Description:
Source:	M
Position:	ChrY:20366926..20366926 (+ strand)
Length:	1
ISOGG_haplogroup:	BT
Mutation:	8T to 9T
YCC_haplogroup:	Approx. hg: BT
allele_anc:	del
allele_der:	ins
comments:	Anc/Der reversed since 2011-12-08
count_derived:	377
count_tested:	436
primer_f:	GAGCTTGGACTTTAGGACGG
primer_r:	AAACTTTAAGGCACTTCTGGC
primary_id:	46372
gbrowse_dbid:	ymap:database